mage microscope platform (Genoscope)
86
Structured Review
Genoscope
mage microscope platform
Mage Microscope Platform, supplied by Genoscope, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mage+microscope+platform/microscope+platform/us12618085-54-17-21
Average 86 stars, based on 1 article reviews
Mage Microscope Platform, supplied by Genoscope, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mage+microscope+platform/microscope+platform/us12618085-54-17-21
Average 86 stars, based on 1 article reviews
mage microscope platform - by Bioz Stars,
2026-10
86/100 stars
Images
Related Articles
Microscopy:Article Title: A Novel erm (44) Gene Variant from a Human Staphylococcus saprophyticus Isolate Confers Resistance to Macrolides and Lincosamides but Not Streptogramins Article Snippet: No circular form could be observed by PCR using GoTaq polymerase (Promega) and plasmid DNA (NucleoBond PC 100; Macherey-Nagel) as the template and using primer1 (5′-CCCGTTGTTACGGGGTTTCT) and primer2 (5′-GCGATAAAGAGCATTTTGATTTTCC) (annealing temperature, 55°C; extension time, 2 min), reading outward of the genomic island ( ). fig ft0 fig mode=article f1 FIG 2 caption a4 Insertion site of genomic island in S. saprophyticus N041 (GenBank accession no. {"type":"entrez-nucleotide","attrs":{"text":"LN623525","term_id":"909637201","term_text":"LN623525"}} LN623525 ) and core genome of S. saprophyticus KACC16562 (GenBank accession ... .. Analysis of Staphylococcus whole-genome sequences using a Article Title: Novel heavy metal resistance gene clusters are present in the genome of Cupriavidus neocaledonicus STM 6070, a new species of Mimosa pudica microsymbiont isolated from heavy-metal-rich mining site soil Article Snippet: .. Gene coordinates for STM 6070 (CT6070v1_XXXXXX-XX) correspond to the annotation in the Article Title: A Novel erm (44) Gene Variant from a Human Staphylococcus saprophyticus Isolate Confers Resistance to Macrolides and Lincosamides but Not Streptogramins Article Snippet: No circular 89 form could be observed by PCR using GoTaq© polymerase (Promega) and plasmid DNA 90 (NucleoBond® PC 100, Macherey-Nagel) as template and using primer1 (5'-91 CCCGTTGTTACGGGGTTTCT) and primer2 (5'-GCGATAAAGAGCATTTTGATTTTCC) 92 (annealing temperature: 55°C, extension time 2 min) reading outwards of the genomic island 93 (Fig. 2). .. 94 95 Analysis of Staphylococcus whole genome sequences using the Article Title: Optimized IBE fermentation method for upgrading acetone Article Snippet: .. The physical map, containing a unique chromosome, one plasmid and one bacteriophage was the annotated using the Article Title: Bacterial SBP56 identified as a Cu-dependent methanethiol oxidase widely distributed in the biosphere Article Snippet: .. The draft genome assembly for Hyphomicrobium sp. VS is available on the Sequencing:Article Title: A Novel erm (44) Gene Variant from a Human Staphylococcus saprophyticus Isolate Confers Resistance to Macrolides and Lincosamides but Not Streptogramins Article Snippet: No circular form could be observed by PCR using GoTaq polymerase (Promega) and plasmid DNA (NucleoBond PC 100; Macherey-Nagel) as the template and using primer1 (5′-CCCGTTGTTACGGGGTTTCT) and primer2 (5′-GCGATAAAGAGCATTTTGATTTTCC) (annealing temperature, 55°C; extension time, 2 min), reading outward of the genomic island ( ). fig ft0 fig mode=article f1 FIG 2 caption a4 Insertion site of genomic island in S. saprophyticus N041 (GenBank accession no. {"type":"entrez-nucleotide","attrs":{"text":"LN623525","term_id":"909637201","term_text":"LN623525"}} LN623525 ) and core genome of S. saprophyticus KACC16562 (GenBank accession ... .. Analysis of Staphylococcus whole-genome sequences using a Article Title: A Novel erm (44) Gene Variant from a Human Staphylococcus saprophyticus Isolate Confers Resistance to Macrolides and Lincosamides but Not Streptogramins Article Snippet: No circular 89 form could be observed by PCR using GoTaq© polymerase (Promega) and plasmid DNA 90 (NucleoBond® PC 100, Macherey-Nagel) as template and using primer1 (5'-91 CCCGTTGTTACGGGGTTTCT) and primer2 (5'-GCGATAAAGAGCATTTTGATTTTCC) 92 (annealing temperature: 55°C, extension time 2 min) reading outwards of the genomic island 93 (Fig. 2). .. 94 95 Analysis of Staphylococcus whole genome sequences using the Plasmid Preparation:Article Title: Optimized IBE fermentation method for upgrading acetone Article Snippet: .. The physical map, containing a unique chromosome, one plasmid and one bacteriophage was the annotated using the |